rs76692773 chr19:44890954 C>T
- Sequence
tccaggagagaggcggggcgatgc[C/T]tcagcgggcgtggcaaaatgctca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) CTV-1 (Adult T acute lymphoblastic leukemia) breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.34 | 1.01 | 2.74 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.56 | 0.37 | 1.00 | |||
| breast tumor | 2.11 | n/a | 2.00 |
Items per page:
1 – 3 of 3