rs771572 chr3:101940812 A>G
- Sequence
ccctgaaacccgatatgtcaggca[A/G]gctggtgggatcctgggatccctc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) macrophages form periferal blood MDA-MB-231 (breast adenocarcinoma) GM23248
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 0.77 | 2.55 | 1.39 | n/a | No Hit |
Items per page:
1 – 1 of 1