rs7726 chr1:26574828 G>A
- Sequence
cttggctctgccagtggatcccct[G/A]cggtcaggctgggcagccccagag
- ASB in cell types
- CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.87 | 0.06 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP antidepressant drug treatment outcome in depression, arthritis including non-rheumatoid, bipolar disorder, diastolic blood pressure (dbp), late onset alzheimers disease, ldl cholesterol, longstanding arthritis, rheumatoid arthritis, tetrology of fallot, waist hip ratio
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellum, Liver, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood