rs773899 chr19:16882314 A>G
- Sequence
gcccagtttttagacgttgagtcc[A/G]gtgggtctgagtgcactcaataaa
- ASB in cell types
- HEK293 (embryonic kidney) CD34+ hematopoietic stem cells K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.07 | 1.06 | 1.99 | |||
| CD34+ hematopoietic stem cells | 4.08 | n/a | 2.00 | |||
| K562 (myelogenous leukemia) | -0.01 | 0.80 | 2.00 |
Items per page:
1 – 3 of 3