rs773945 chr10:34528415 C>T
- Sequence
tgccaggaattccactcattctac[C/T]accacaaggttgctaatcatgaat
- ASB in cell types
- BEAS-2B (bronchial epithelium) 2588 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 1.00 | 0.68 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, homa-b, ldl cholesterol, total cholesterol, total cholesterol change with statins, triglycerides