rs774628 chr6:137805141 T>C
- Sequence
gcaaaattttctaatctaggagct[T/C]ttctactcagaaacaggtttggtt
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | -4.79 | 2.70 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, comorbid depressive syndrome and alcohol dependence, eye color, hip bone mineral density (bmd), maternal transmission distortion, rheumatoid arthritis, spine bone mineral density (bmd), systemic lupus erythematosus (sle), transmission distortion