rs7757460 chr6:38872377 A>G
- Sequence
tttataacgtggtgctcatttgct[A/G]tgcacatctagtaaaacaacattt
- ASB in cell types
- GM18951 (B-cells Lymphoblastoid Cell Lines) GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18951 (B-cells Lymphoblastoid Cell Lines) | 1.38 | -0.52 | 1.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 0.70 | -0.67 | 1.00 |
Items per page:
1 – 2 of 2