rs7759256 chr6:13229422 T>C
- Sequence
agccctgcctcagctgctcagaaa[T/C]gctggggttgaaaagaaaaaaccc
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) GM18526 (B – cells Lymphoblastoid Cell Lines) GM19240 (B cells Lymphoblastoid Cell Lines) RWPE2
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | -1.19 | 1.50 | 1.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -1.00 | 1.38 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | 1.14 | -0.92 | 1.00 | |||
| RWPE2 | 2.96 | -3.10 | 1.00 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 1.52 | -0.90 | 1.00 |
Items per page:
1 – 5 of 5