rs7759668 chr6:33702629 T>C
- Sequence
atacagaggaggtgtggtcttttc[T/C]cttgcacctcttctaactttccct
- ASB in cell types
- PANC1 (pancreatic ductal adenocarcinoma) neural progenitors transverse colon pancreas
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.04 | 1.77 | 1.62 | n/a | No Hit | |||
| STAG1_HUMAN | -0.79 | 1.52 | 2.33 | n/a | n/a | |||
| RAD21_HUMAN | -0.31 | 1.28 | 1.57 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), college completion, diabetic retinopathy in type 2 diabetes mellitus, fasting blood glucose, height, obesity (body mass index (bmi)), rheumatoid arthritis, rheumatoid arthritis (acpa-positive), rheumatoid arthritis, combined control dataset, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood