rs7759881 chr6:51855410 C>T
- Sequence
tcttcactgctcttatttgtctcc[C/T]ttaacccaatccagcctggggact
- ASB in cell types
- K562 (myelogenous leukemia) H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.94 | 0.05 | 2.51 | |||
| H929 (plasma cell myeloma) | -2.48 | 1.54 | 1.50 |
Items per page:
1 – 2 of 2