rs7760616 chr6:134111076 G>A
- Sequence
tggaagttgcagtgagcagagatc[G/A]tgccattgcactccagcctgggaa
- ASB in cell types
- HepG2 (hepatoblastoma) NB69 (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.86 | 2.02 | 2.00 | |||
| NB69 (neuroblastoma) | 2.62 | -2.34 | 1.00 |
Items per page:
1 – 2 of 2