rs7763695 chr6:34104784 T>C
- Sequence
tctgagcctcagtttctgcatctg[T/C]tcaatgggggcttaattacatgac
- ASB in cell types
- HDF(human dermal fibroblasts)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HDF(human dermal fibroblasts) | 2.52 | 0.93 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, advanced age-related macular degeneration, college completion, cystatin c in serum, parkinsons disease, prop taste detection threshold, years of education