rs7765503 chr6:139369608 A>T
- Sequence
cagaaatggcaacaaaacaaacaa[A/T]aaagcgaaaaagctcttgaggaaa
- ASB in cell types
- K562 (myelogenous leukemia) G401 (rhabdoid tumor of the kidney) THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.73 | 0.73 | 1.11 | |||
| G401 (rhabdoid tumor of the kidney) | 1.96 | -1.45 | 1.00 | |||
| THP-1 (acute monocytic leukemia) | 0.78 | 0.26 | 2.00 |
Items per page:
1 – 3 of 3