rs7765648 chr6:44001520 C>G
- Sequence
taatggaggaggagcctccagcag[C/G]ctggggtggggtgggggtgggaga
- ASB in cell types
- GM17942 (lymphoblastoid cell) 2588 (Lymphoblastoid Cell Lines) ID00014 (lymphoblastoid cell, DiGeorge syndrome) GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM17942 (lymphoblastoid cell) | 1.55 | -1.55 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | -0.92 | 0.80 | 1.00 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | -1.54 | 1.54 | 1.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | 0.96 | -0.64 | 1.17 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Heart_Atrial_Appendage, Heart_Left_Ventricle, Testis, Thyroid