rs7768380 chr6:43753924 G>A
- Sequence
cgagtgcatgcatgtgggtgtgta[G/A]gtgtgtgtgcatatgtgagtgtgt
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma) pulmonary artery endothelial cell
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.30 | 1.05 | 2.98 | |||
| HepG2 (hepatoblastoma) | 0.14 | 1.15 | 2.00 | |||
| pulmonary artery endothelial cell | 1.46 | 0.14 | 1.00 |
Items per page:
1 – 3 of 3