rs7768522 chr6:169624083 T>C
- Sequence
ccgtgtgtggggtcaggtgtgccg[T/C]gtgcagcatgtggcatcaggtgtg
- ASB in cell types
- TMD8 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- ITF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ITF2_HUMAN | -1.46 | 2.50 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid