rs7769164 chr6:36320644 G>A
- Sequence
atctgtgtttgtctctcaaagtag[G/A]ctgtgttttccaagggtggggaac
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7L-P(immortalized breast epithelial cell line) | 0.14 | 1.44 | 1.00 |
Items per page:
1 – 1 of 1