rs7769489 chr6:3209354 A>G
- Sequence
ccgccctagaccaactaagccaga[A/G]tctgcatttaactagatccccagg
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells) BEAS-2B (bronchial epithelium) GM12892 (female B-cells lymphoblastoid cell line) HMEC (human mammary epithelial cells)
- ASB for transcription factors
- GCR_HUMAN CTCF_HUMAN STAG1_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 1.04 | 1.34 | 1.00 | n/a | No Hit | |||
| CTCF_HUMAN | -0.02 | 0.96 | 1.65 | n/a | No Hit | |||
| STAG1_HUMAN | -0.30 | 0.96 | 1.10 | n/a | n/a | |||
| JUN_HUMAN | 2.44 | 0.66 | 1.25 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood