rs7769906 chr6:35299938 C>T
- Sequence
gtggtcaaaaggcaaaggaggaag[C/T]agacgagagagttatacaagcagg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) THP-1 (acute monocytic leukemia) macrophages form periferal blood
- ASB for transcription factors
- ELF1_HUMAN IKZF2_HUMAN SPI1_HUMAN SRF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ELF1_HUMAN | -1.88 | 2.15 | 1.00 | 0.88 | Weak Concordant | |||
| IKZF2_HUMAN | -0.77 | 1.47 | 1.00 | n/a | n/a | |||
| SPI1_HUMAN | 0.16 | 1.74 | 1.85 | 3.18 | Concordant | |||
| SRF_HUMAN | -2.15 | 2.42 | 1.00 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood