rs7770081 chr6:132768430 G>T
- Sequence
ggtttgaggggatagggaaatgaa[G/T]agatcacaagacagatgtacatcc
- ASB in cell types
- neutrophils from periferal blood GM18505 (female B-cells Lymphoblastoid Cell Lines) GM02610 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -0.27 | 1.06 | 1.11 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, barnes akathisia rating scale, cisplatin ic50 in b lymphoblastoid cell lines, diabetic nephropathy in type 2 diabetes mellitus - end stage renal disease, fasting insulin, homa-ir, irritible bowel syndrome, mitral annular calcium, rheumatoid arthritis, tardive dyskinesia, total cholesterol, type 2 diabetes, end stage renal disease
GTEx eQTL Adrenal_Gland, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Spleen, Thyroid, Whole_Blood