rs7770626 chr6:162250307 C>A
- Sequence
ttttcctattggcagggagctgta[C/A]cactttgtagaggctgagatacct
- ASB in cell types
- LNCaP95 22RV1 (prostate carcinoma) LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP95 | -0.06 | 1.53 | 2.00 | |||
| 22RV1 (prostate carcinoma) | 3.20 | -2.96 | 2.00 | |||
| LNCaP (prostate carcinoma) | -0.25 | 1.08 | 1.46 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, diastolic blood pressure (dbp), infant head circumference, parkinsons disease