rs7770731 chr6:14598589 T>C
- Sequence
aaataaaataccccttgggaaatc[T/C]attaatgttagaatactgtgttct
- ASB in cell types
- LNCaP (prostate carcinoma) LNCaP95 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN A2NVP9_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.30 | 0.31 | 1.87 | n/a | No Hit | |||
| A2NVP9_HUMAN | 2.10 | -4.71 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, autism, hdl cholesterol, irritible bowel syndrome, obesity with early age of onset (age >2), parkinsons disease, partial epilepsy, response to quetiapine on working memory in schizophrenia patients, total cholesterol, triglycerides
PheWAS abdominal hernia, abdominal pain, abnormal coagulation profile, abnormal reflex, abnormality of red blood cells, adjustment reaction, adverse effects of insulins and antidiabetic agents, allergy/adverse effect of penicillin, aphakia and other disorders of lens, bacterial enteritis, balanoposthitis, calcium/phosphorus disorders, cancer of larynx, cholelithiasis, cholelithiasis and cholecystitis, complication of amputation stump, degeneration of intervertebral disc, dermatomyositis and polymyositis, diseases of the salivary glands, disorders of esophageal motility, disorders of mineral metabolism, disturbances of sensation of smell and taste, dyschromia and vitiligo, eating disorder, empyema and pneumothorax, essential tremor, extrapyramidal disease and abnormal movement disorders, first degree av block, fracture of neck of femur, gastrointestinal malfunction arising from mental factors, gastroparesis, generalized hyperhidrosis, giant cell arteritis, gout and other crystal arthropathies, gram negative septicemia, hypocalcemia, inflammation of eyelids, inguinal hernia, insulin pump user, intervertebral disc disorders, localized adiposity, morbid obesity, myopia, neoplasm of unspecified nature of digestive system, noninflammatory disorders of cervix, noninflammatory disorders of ovary, fallopian tube, & broad ligament, obstructive sleep apnea, osteoarthritis, localized, osteoarthrosis nos, other abnormal blood chemistry, other peripheral nerve disorders, ovarian cyst, overweight, pallor and flushing, peripheral angiopathy in diseases classified elsewhere, personality disorders, pleurisy, pleural effusion, pneumonia, poisoning by hormones and synthetic substitutes, premature beats, protein plasma/amino-acid transport and metabolism disorder, psychogenic disorder, pulmonary collapse, interstitial/compensatory emphysema, schizoid personality disorder, sialoadenitis, sleep apnea, subdural hemorrhage, suppurative and unspecified otitis media, type 2 diabetic retinopathy, urticaria