rs7770934 chr6:12077489 G>A
- Sequence
agtcatctgcacttgtcatctttc[G/A]taggcatgtgatggggaagtgaga
- ASB in cell types
- monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | 2.58 | -1.59 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), autism, cystatin c in serum, fasting blood glucose, venous thrombosis