rs7771074 chr6:140586905 T>G
- Sequence
acataaccccacgcagatgacaaa[T/G]aaccagtgcaagaacactggcaac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) CAR-T cells
- ASB for transcription factors
- RUNX3_HUMAN IRF4_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RUNX3_HUMAN | 3.25 | -3.24 | 1.00 | n/a | No Hit | |||
| IRF4_HUMAN | 2.01 | 0.45 | 1.00 | n/a | No Hit | |||
| IKZF2_HUMAN | 0.90 | -0.82 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Colon_Transverse, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pituitary, Thyroid, Whole_Blood