rs7771861 chr6:73232247 A>C
- Sequence
ttgtggaaagcagtatagtgattc[A/C]tcaagctgctaaaagcagaagtgc
- ASB in cell types
- macrophages form periferal blood monocyte-derived dendritic cells
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.70 | -0.09 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1