rs7772956 chr6:20529311 G>T
- Sequence
gttaaattatgcagagaaaattca[G/T]catttgtccaaagacaataggagg
- ASB in cell types
- HCT-116-RAD21-mAC vagina
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCT-116-RAD21-mAC | -0.88 | 1.54 | 1.00 | |||
| vagina | -2.33 | 2.67 | 1.00 |
Items per page:
1 – 2 of 2