rs7773199 chr6:66558296 T>C
- Sequence
aagttcaccttgttccctattcac[T/C]tgtgtcagtgaatttttgattgga
- ASB for transcription factors
- CTCF_HUMAN ZN574_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.60 | 1.11 | 1.17 | n/a | No Hit | |||
| ZN574_HUMAN | -2.41 | 2.65 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, hypertension (early onset hypertension), paternal transmission distortion, transmission distortion