rs7776274 chr6:330299 G>C
- Sequence
ctccccctccttgtgttttgaaga[G/C]gctcctgcagggatccagttctgt
- ASB in cell types
- HEK293 (embryonic kidney) GM19238 (female B-cells lymphoblastoid cell lines) GM02255 (Lymphoblastoid Cell Lines) GM18505 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- MBD4_HUMAN ZN366_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MBD4_HUMAN | 2.27 | n/a | 1.00 | n/a | n/a | |||
| ZN366_HUMAN | 2.73 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2