rs7776969 chr7:153134989 A>G
- Sequence
cttctagaatttttgtggtttcac[A/G]tcttagatttaagtccttgataca
- ASB for transcription factors
- TLE3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TLE3_HUMAN | -2.06 | 2.84 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), chronic kidney disease, diastolic blood pressure (dbp), systolic blood pressure (sbp)