rs7777863 chr7:124174986 A>T
- Sequence
ggggtttcattgcatagctatgat[A/T]gattgaattattggtcacatgttc
- ASB for transcription factors
- DUX4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| DUX4_HUMAN | -0.56 | 1.10 | 1.00 | 3.32 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
