rs7778641 chr7:145009858 A>G
- Sequence
gacacacagtcttcgggctgagcc[A/G]aggtggatgttttgagcacagttg
- ASB in cell types
- SU-DHL-1 (Anaplastic large cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SU-DHL-1 (Anaplastic large cell lymphoma) | n/a | 2.91 | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, fasting blood glucose, fasting insulin, hdl cholesterol, hdl cholesterol change with statins, homa-ir, ldl cholesterol, obesity with early age of onset (age >2)