rs7780021 chr7:131556326 G>A
- Sequence
gcagcggcggcgttgacaacagta[G/A]cagcagcgccgagagcgccagcgc
- ASB in cell types
- K562 (myelogenous leukemia) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.01 | 0.69 | 1.49 | |||
| 22RV1 (prostate carcinoma) | 2.06 | -1.25 | 2.00 |
Items per page:
1 – 2 of 2