rs7780142 chr7:142712527 A>T
- Sequence
catctttaaggaaccattcagccc[A/T]ccactccgatgttccactagaggg
- ASB in cell types
- HeLa Kyoto (cervical adenocarcinoma) GM12891 (male B- cells lymphoblastoid cell line) tibial artery HeLa (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa Kyoto (cervical adenocarcinoma) | 2.23 | -1.03 | 2.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 0.90 | -0.55 | 1.00 | |||
| tibial artery | 2.56 | n/a | 1.00 | |||
| HeLa (cervical adenocarcinoma) | -0.27 | 1.21 | 1.50 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Lung, Minor_Salivary_Gland, Nerve_Tibial, Pancreas, Prostate, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Vagina, Whole_Blood