rs77804600 chr1:2391602 T>C
- Sequence
attggtctttgtcgcaaggggggg[T/C]gtggccacgggcctagtccctgag
- ASB in cell types
- HepG2 (hepatoblastoma) CD34+ hematopoietic stem cells-derived proerythroblasts CD14+ monocytes HeLa (cervical adenocarcinoma)
- ASB for transcription factors
- RBM25_HUMAN GATA1_HUMAN STAT1_HUMAN TYY1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RBM25_HUMAN | 1.69 | -2.81 | 1.50 | n/a | n/a | |||
| GATA1_HUMAN | 2.54 | 0.25 | 1.83 | n/a | No Hit | |||
| STAT1_HUMAN | 2.57 | n/a | 3.00 | n/a | No Hit | |||
| TYY1_HUMAN | 1.10 | 0.74 | 1.38 | n/a | No Hit | |||
| TCF21_HUMAN | 1.64 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood