rs7781141 chr7:4883930 C>A
- Sequence
ggatgcagcctcgagggggcgggg[C/A]ctcaccggagaggcggggttttga
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines) PANC1 (pancreatic ductal adenocarcinoma) A549 (lung carcinoma) GM02630 (Fanconi anemi)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | -1.01 | 1.44 | 1.00 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | -1.17 | 1.18 | 1.00 | |||
| A549 (lung carcinoma) | 1.07 | 0.23 | 2.00 | |||
| GM02630 (Fanconi anemi) | 0.94 | -0.84 | 1.00 |
Items per page:
1 – 4 of 4