rs7781710 chr7:15016420 T>A
- Sequence
agcttacagcactgttgcatgtga[T/A]aaaaatcagcaaagacattgcgac
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) GM19240 (B cells Lymphoblastoid Cell Lines) GBM39 (Human brain tumor)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -0.99 | 1.27 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | -1.22 | 1.17 | 1.00 | |||
| GBM39 (Human brain tumor) | 1.46 | -0.67 | 2.00 |
Items per page:
1 – 3 of 3