rs7782304 chr7:16399772 G>A
- Sequence
cacgtttctcacaagtgacaagtg[G/A]ctgacatgcttggcacgtgaccaa
- ASB in cell types
- neural cell A549 (lung carcinoma)
- ASB for transcription factors
- EP300_HUMAN USF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP300_HUMAN | -0.23 | 1.36 | 1.25 | n/a | n/a | |||
| USF2_HUMAN | n/a | 0.93 | 2.00 | 0.77 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Caudate_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid