rs7783403 chr7:98295192 G>C
- Sequence
gccgttcctggacatggaggccca[G/C]gccaggcctcctctgggatggcct
- ASB in cell types
- foreskin keratinocyte HEK293 (embryonic kidney) GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.20 | -2.52 | 1.44 | |||
| HEK293 (embryonic kidney) | 0.02 | 0.77 | 1.94 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | -0.34 | 1.99 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood