rs7784011 chr7:136406344 G>C
- Sequence
ccccgcagttgtagatgtgattct[G/C]cttcctagtaaaagaaacttgcaa
- ASB in cell types
- glioblastoma cells K562 (myelogenous leukemia) foreskin keratinocyte GM23338
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | 2.88 | -0.58 | 2.00 | |||
| K562 (myelogenous leukemia) | 0.53 | 0.10 | 1.49 | |||
| foreskin keratinocyte | 1.36 | n/a | 2.17 | |||
| GM23338 | 1.27 | -0.18 | 1.17 | |||
| erythroid progenitors | 2.14 | -1.22 | 2.00 |
Items per page:
1 – 5 of 5