rs7785039 chr7:95430930 T>C
- Sequence
aaaaaaaagggaaaaaggctgctc[T/C]ttcagaagtagaaacagaccacat
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- IKZF2_HUMAN IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | 2.56 | n/a | 1.00 | n/a | n/a | |||
| IKZF1_HUMAN | 2.15 | -4.02 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Colon_Transverse, Esophagus_Muscularis, Lung, Minor_Salivary_Gland, Nerve_Tibial, Ovary, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood