rs7786781 chr7:87370549 T>C
- Sequence
tctaattgttttctaattgttggg[T/C]atatatatctatttataacttaaa
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 2.69 | -5.02 | 2.00 | -1.46 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP bipolar disorder, birth weight, college completion, comorbid depressive syndrome and alcohol dependence, mitral annular calcium, triglycerides, years of education
GTEx eQTL Artery_Aorta, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg