rs7787362 chr7:73978273 T>C
- Sequence
gcatgaacatgactgtaaactggg[T/C]gccctttccccttcaagcctgtgg
- ASB in cell types
- keratinocytes SU-DHL-2 (anaplastic large cell lymphoma)
- ASB for transcription factors
- SNAI2_HUMAN ITF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | n/a | 3.00 | 1.00 | n/a | No Hit | |||
| ITF2_HUMAN | -1.37 | 2.40 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration (geographic atrophy), college completion, comorbid depressive syndrome and alcohol dependence, nonsyndromic striae distensae (stretch marks), striae gravidarum (stretch marks during pregnancy), total cholesterol, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Heart_Atrial_Appendage, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg