rs7787802 chr7:22082945 G>T
- Sequence
aacagtctctgtctgggaactgcg[G/T]ttgcctaaggctcggtttgctctt
- ASB in cell types
- glioblastoma cells BE2C erythroid cells MDA-MB-453 (breast adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | 2.40 | n/a | 2.00 | |||
| BE2C | 2.65 | n/a | 1.00 | |||
| erythroid cells | 2.09 | -4.00 | 1.50 | |||
| MDA-MB-453 (breast adenocarcinoma) | 2.05 | 0.09 | 1.50 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol, microalbuminuria, rheumatoid arthritis