rs7788066 chr7:124990091 A>G
- Sequence
ggacatttgccaggaaaataggta[A/G]gaatgactactaagatgactacta
- ASB in cell types
- HASM2 (Human airway smooth muscle 2)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HASM2 (Human airway smooth muscle 2) | -0.38 | 1.27 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Heart_Atrial_Appendage, Lung, Pancreas, Spleen, Thyroid