rs778812 chr19:5822495 C>T
- Sequence
ccagacggcgtcgagtgtggtggg[C/T]gtgtacacgtgagttattaaacac
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- GLIS1_HUMAN ZIC2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GLIS1_HUMAN | 1.66 | -0.96 | 2.00 | 1.59 | Weak Discordant | |||
| ZIC2_HUMAN | 2.71 | -1.91 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Esophagus_Mucosa, Heart_Atrial_Appendage, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis