rs7789505 chr7:21352849 G>A
- Sequence
tctgtacccttcagttacatgccc[G/A]aggatatcccaatttttcttcagc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.75 | 1.08 | 1.13 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, hdl cholesterol, infant head circumference, serum creatinine, stabilized warfarin dose