rs7790874 chr7:6602412 C>T
- Sequence
gcacctgttgagtggtgggtgtgg[C/T]gcagggggccctctgttggtggca
- ASB in cell types
- T47D (invasive ductal carcinoma) Peyer's patch esophagus squamous epithelium CD14+ monocytes
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN STAT1_HUMAN CTBP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.50 | 0.98 | 1.35 | 0.35 | Weak Concordant | |||
| STAG1_HUMAN | -0.58 | 1.19 | 1.12 | n/a | n/a | |||
| STAT1_HUMAN | 2.17 | -0.28 | 2.00 | n/a | No Hit | |||
| CTBP1_HUMAN | n/a | 2.82 | 2.00 | n/a | n/a | |||
| ILF3_HUMAN | n/a | 2.62 | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Stomach, Testis, Thyroid, Whole_Blood