rs7791909 chr7:47763600 G>C
- Sequence
aaggtgagtatttctaaggctgtc[G/C]tggccacgggaggaccggagaata
- ASB in cell types
- SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | 0.06 | 1.32 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Liver, Minor_Salivary_Gland, Pituitary, Small_Intestine_Terminal_Ileum, Spleen