rs7792834 chr7:91628794 G>A
- Sequence
ttgagctcttcaagaaaacaaaat[G/A]caaacggaccgtaaatgtgtttta
- ASB in cell types
- 22RV1 (prostate carcinoma) HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 1.38 | -3.75 | 2.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.13 | -4.20 | 2.50 |
Items per page:
1 – 2 of 2