rs7793114 chr7:139750986 T>C
- Sequence
ttattgtctgcatatctgtaattc[T/C]ttttcttcctaactttgaacttct
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.14 | 1.06 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), college completion, irritible bowel syndrome, paternal transmission distortion, resistance to kuru in aged women despite likely exposure, schizophrenia, transmission distortion